ailani9 ailani9

06-06-2023
Biology

contestada

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Respuesta :

Otras preguntas

The people in the highest social class In the city states of sumer were?

As one travels east into the next time zone, the time is one hour _____?

gabriella wants to tile a room with an area of 320 square feet. the width of the room is 4/5 its length. what are the length and width of the room?

How do governments get the money for the goods and services that they provide? They print money as they need it. All government spending comes directly from tax

The Napoleonic Code required that family property _____. A. be divided among sons and daughters B. be given to the eldest son C. be given to the State D. be giv

Why did American officials make plans to invade Cuba? (Points : 1) They were alarmed to see communism gaining a foothold in the Western Hemisphere. They wanted

As Chinese leader, what did Mao Zedong accomplish He systematically dismantled the Nationalist Party. He seized control of Taiwan from Chiang Kai-shek. He redis

Who controlled South Korea following World War II? A. The United States B. The United Nations C. Japan D. China

The British originally established Australia to be what type of colony? agricultural industrial mining penal

Merritt Island National Wildlife Refuge is an important Florida wildlife sanctuary for birds. Recently, an energy corporation has proposed constructing wind tur