Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Respuesta :

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.