nihanjoy3
nihanjoy3
09-05-2018
Biology
contestada
Not the first one.
Just 2nd question.
Respuesta :
surfingBMXdrago
surfingBMXdrago
09-05-2018
The pond will continue to get smaller and posibly will not exist at all. The area will be covered in shrubs because the dirt had softened because of the water. I think this might be the answer or something like it. Hope this helps!
Answer Link
VER TODAS LAS RESPUESTAS ( 11+ )
Otras preguntas
Busca el número del vuelo en A. la maleta B. la billetera C. la pantalla
Read this passage, and highlight any participial phrases. The alarm clock, dented from too many tumbles off the nightstand, buzzed insistently. Akiko hit the sn
Explain how various Presidents views have shaped the powers of office?
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Type the Word income Definition Income is money coming in through wages, allowance or other sources. Usage income
PLEASE HELP! What are the steps used to construct a hexagon inscribed in a circle using a straightedge and a compass? Drag the choices to order them correctly.
Suppose you invest $75 a month in an annuity that earns 48% APR compounded monthly. How much money will you have in this account after 3 years?
Calculate the constant of variation if y varies directly as x. y = -3 x = 2 Answers available: -2/3 -3/2 -1
The diagram shows the stages of the eukaryotic cell cycle which stage is labled c in the diagram
The average cost of 5 kits was $9.50. The first kit costs $11.25, the second kit cost $8.75, the third kit cost $9.35, and the fourth kit cost $8.90. Find the c
