Nasri11 Nasri11

11-09-2018
Geography

contestada

Why are maps useful tools?

Respuesta :

11-09-2018

There are different types of maps, which have different benefits. Ex, a weather map.
Generally speaking, maps help us locate certain areas. Maps can also help historians see how places have altered over time.

Answer Link

Otras preguntas

Question 1 (1 point) A box of eleven chocolates contains: four Milk Chocolates, four Dark Chocolates, and three White Chocolates. Find the probability you rando

-- --... - - 1. Name the two sources of bills that are presented to members of Congress.

Describe four ways a city can reduce car use.

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

Mythology: What are 10 main facts to know about Cronus?

easy please quickly answer giving brainiest

How did treaty of nanjing led to the overthrow of the dyansty

The mathematical relationship between current, voltage and resistance is known as

The diagram above shows the countries’ places on a spectrum based on their __________. A. economic systems B. economic production C. imports and exports D. indu

Two consecutive even Integers whose product is 80