raybeaty raybeaty

07-03-2019
Mathematics

contestada

Are 9(4-x) and 36-9x equivalent expressions explain how you know

Respuesta :

07-03-2019

The expressions are equivilant because of the distributive property.

Answer Link

Otras preguntas

A cylinder is inscribed in a right circular cone of height 5.5 and radius (at the base) equal to 5. What are the dimensions of such a cylinder which has maximum

Sarah stopped at the supermarket to quickly pick up some milk, bread, cat litter, and a tomato. When she saw the total come up on the screen, she swore that it

do we say : Jay layed on the floor Jay laid on the floor Jay lay on the floor Jay lied on the floor thanks !

A printer needs to make a poster that will have a total of 500 cm2 that will have 3 cm margins on the sides and 2 cm margins on the top and bottom. What dimensi

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

A satellite of mass m is in a circular orbit of radius R2 around a spherical planet of radius R1 made of a material with density p. ( R2 is measured from the ce

joey’s mom wants him to wear his rain boots to school today because it is raining. She nags him several times to take the boots but he argues that he doesn’t ne

which two processes in the carbon cycle are also parts of oxygen cycle

A customer buys 1 OEX Jan 530 Put @ $3. The overall market falls and the index closes at 529, while OEX 530 Put contracts close at $4.50. Which is the most prof

Which sentence quotes a research source correctly? The problem is not one of quantity, but of quality (page 8). The problem is not one of quantity, but of quali