ineedhelpireallydo ineedhelpireallydo

06-04-2020
Mathematics

contestada

Can anyone help me with this problem?

Can anyone help me with this problem class=

Respuesta :

meehannola meehannola

06-04-2020

Answer: The number of tomatoes went up relative to the increase of fertilizer used. the slope is positive.

Step-by-step explanation:

Answer Link

Otras preguntas

What form of raditation decay is common for very heavy nuclei?

Tim suffers from attention deficit hyperactivity disorder (adhd). his teachers and parents reward him with stars for desirable behaviors. the more stars he rece

Are the statements about hydrogen bonding of the compound below with water true or false? this compound can act as a hydrogen-bond donor. this compound can act

Noam is building an aquarium. He needs to install a system to isolate biological matter and keep the water from getting too dirty. The water is continuously fed

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which statement best describes weather ?

Which of the following comparisons of fusion and fission is correct? A. Both fission and fusion result in products that are heavier than the reactants. B. Both

It took 25.5 bottles to fill a cooler and each bottle contained 1.8 liters. How many liters are in the cooler

yolanda hiked each day for a week. The first day she hiked 1\5mile, the second day she hiked 3\5 mile,and the the third day she hiked 1 mile. By how much did sh

Hannah is a strict parent, and does not recall that she herself got drunk at her senior prom, which does not "fit" with the way she currently views herself. thi