abusyed3224 abusyed3224

09-04-2020
Mathematics

contestada

Akib brought 3 8/10 pounds of grapes. He ate 1 4/10 pounds of grapes. How many pounds of grapes does Akib have left? Write your answer in simplest form.

Respuesta :

TouchBrain TouchBrain

09-04-2020

Answer:

1 2/5

Step-by-step explanation:

3 8/10 - 2 4/10 will give you 1 4/10 which simplifies to 1 2/5.

Answer Link

Otras preguntas

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

The scientific method often begins by asking questions about the natural world. Which of the following is an example of a scientific question? How does fertili

What led to Great Britain increasing taxes

where x1 and x2 represent number of units of production of basic and advanced iPods, respectively. Production time required for the basic iPod is 6 hours per un

Beerbo Inc. traded a used truck for a new truck. Before this exchange of non-monetary assets (ENMA), Beerbo's balance sheet show the used truck at a cost of $30

Can someone help me pls?

Which of the following describes contango? A. The futures price is below the expected future spot price B. The futures price is below today’s spot price C. The

Jamal is a New York City firefighter/paramedic. People who know him say that he is calm and level-headed no matter what the situation. This is one reason his su

. Dallas Wildcat Drilling Co. sells an oil-drilling rig for $3,000,000. The drilling rig was purchased in 2013 for $2,000,000. Depreciation deductions of $1,200

During ecological succession, how does the growth of young hardwoods affect the organisms living in an ecosystem? A Grasses and low shrubs are unable to obtai