lilleybovard lilleybovard

14-04-2021
Mathematics

contestada

See Photo for information on how to answer

See Photo for information on how to answer class=

Respuesta :

ilickpuh ilickpuh

14-04-2021

Answer:

It is a Geometric sequence

Common ratio = 1/5

Step-by-step explanation:

Whole chain: 25, 5, 1, 1/5, 1/25, 1/125, 1/625, 1/3125

Hope this helped

Ver imagen ilickpuh

Ver imagen ilickpuh

Answer Link

Otras preguntas

MAIN QUESTION TO HELP THESE IS: a skydiver jumps out a hovering helicopter, so there is no forward velocity. ignore wind resistance. what is the skydiver’s vel

How did courts once interpret the equal protection clause to rule in favor of laws that segregated white Americans and African Americans? O A. They argued that

How doestuaries help protect the state fromstorms and hurricanes?

An air-conditioner with refrigerant-134a as the working fluid is used to keep a room at 238C by rejecting the waste heat to the outdoor air at 348C. The room ga

The writers of the Constitution used the term ________ to describe a form of government that consists of carefully designed institutions that are responsive to

EB1. LO 2.1Winterfell Products manufactures electrical switches for the aerospace industry. For the year ending 2019, they reported these revenues and expenses

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m

Please help me with this quiz Question 1 (1 point) (9.23_Q1) In a closed circuit, the electricity can flow from the negative battery terminal to the positive te

When you combine chocolate powder and milk, the result is best describe as

what washes up on small beaches