atreazure atreazure

09-03-2022
Biology

contestada

What is the mRNA that would be transcribed from this strand of DNA?

What is the mRNA that would be transcribed from this strand of DNA class=

Respuesta :

karisoar karisoar

09-03-2022

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

Answer Link

Otras preguntas

If the force on a cart is doubled, what happens to the acceleration of the cart?.

d) Qui sont les Kanaks? e) Quel est le sport favori des Calédoniens ? f) Que protège l'UNESCO depuis 2008 ? g) Les totems et les masques sont fabriqués de bois.

The blank of two sides of a triangle is greater than the length of the third side. (Triangle Inequality Corollary)

What is the current policy in place ( if there is one)

You are sewing a hem on a sewing machine when you notice that the individual stitches are too tight. After you finish the hem, you tug on it to even out the sti

Games at the carnival costs $9 each. The prizes awarded to the winners costs the owner $207.35. How many games must be played for the owner to make more than $1

When designing a security-in-depth strategy, security measures such as firewalls, vpns and sll would be examples of what type of control?.

Why and how are Asian Americans rendered invisible in the national dialogue and in scientific research? What are the barriers to mental health for Asian America

At a bus station, The buses leaving for Lewes and eastbourne both leave together at 8 a.m. following this, the bus to Lewes leaves every 20 minutes and the bus

A football team loses 4 yards on each of 9 consecutive plays. Find the total change in yards from where the team started.