hruiz29680 hruiz29680

08-04-2022
Mathematics

contestada

can someone please help me out with these three questions please please please!!!!

can someone please help me out with these three questions please please please class=

Respuesta :

baruaprangon5 baruaprangon5

08-04-2022

Answer: 4. A 5. C 6. D

Step-by-step explanation: that’s it!!!!!!!!!!

Answer Link

Otras preguntas

Answer below.[tex](x = 5)(y = 7)[/tex][tex]12x \times 2 = [/tex][tex]12y + 6 - x + y[/tex]Answer all of these.

Select the equations of the lines that are parallel to the line whose equation is y = 3x + 5. 6x + 2y = 12 -3x + y = 8 3y = 9x

A steel pot has a bottom with a cross sectional area of .1m2 and has a thickness of 1cm. The pot is filled with boiling water and the bottom of the pot is held

Use the following sentence to answer the question. Her sketches are unusual because of their unusual perspective, radical use of color, and she uses unexpected

Say the slope value of the next line -5x + 3y=30A. m= -5/3B. m= -3/5C. m= 5/3D. m= 3/5

What is the term for the symbiotic association between fungi and cyanobacteria? lichen mycorrhizae epiphyte nitrogen-fixing nodule

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

A(n) __________ infection is a small region of infection from which a pathogen may move to another part of the body to establish a second infection.

Stem regions at which leaves are attached are called ________. trichomes lenticels nodes internodes

What kind of stain is most commonly used to visualize the capsule of cryptococcus? Gram stain simple stain negative stain fluorescent stain