tabionjones tabionjones

07-03-2017
Geography

contestada

Write an expression that gives the area of the shaded region in the figure.

Write an expression that gives the area of the shaded region in the figure class=

Respuesta :

sara156 sara156

07-03-2017

15-4= 11 (length)

14-6= 8 (width)

Area = 11*8 = 88ft^2

Answer Link

lyair3799 lyair3799

08-04-2021

Answer: A = ( 15 - 4 ) x ( 14 - 6 )

Explanation:

Answer Link

Otras preguntas

111212023 Mu Given: U = 13-5 2 14 11 -805 V = 13-1-7 -6119 0 15 23 Solve: X+U=V X =

S R 20 16 येकपू 4 + N U (SPP)

A beam of light traveling in air has a wavelength of 525 nm. If the light illuminates a diffraction grating with 2800 lines/cm, What is the angle of the third-o

Three complexes,[CoCl(NH₃)₅]²⁺(I),[Co(NH₃)₅H₂O]³⁺(II) and[Co(NH₃)₆]³⁺(III)absorb light in the visible region. The correct order of the wavelength of light absor

How does the film include both perspectives of Henrietta's life and Hopkins' research? Does it include both perspectives?

Franklin Corporation, which makes and sells 80,900 radios annually, currently purchases the radio speakers it uses for $17 each. Each radio uses one speaker. Th

Which of the following functions represent a practically possible wave (with finite displacement at all points)?a. (x - vt)²b. log(x + vt)c. e⁻⁽ˣ ⁻ ᵛᵗ⁾²d. 1/x +

Instructions: Given that a bag of skittles has 15 blue candies, 16 orange candies, 12 yellow, 14 red, and 5 green candies, find the following 6. What is the p

Deskripsi tentang pantai kuta menggunakan bahasa inggris

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA