BrainCraze78 BrainCraze78

07-09-2017
Social Studies

contestada

Which of these was a common motivation for people from European countries when exploring the Americas during the 16th century

Respuesta :

laverym181 laverym181

07-09-2017

The correct answer would be D) A sense of Adventure by those exploring the New World

Answer Link

DtheConqueror DtheConqueror

11-09-2017

It is D (Sense of adventure)

Answer Link

Otras preguntas

A recipe for brownies calls for 2.5 cups of flour. The recipe makes 10 servings. How many cups of flour are needed to make 13 servings ? 5cups, 3.25cups, 8 cups

__________ refers to the tendency to regard one’s own culture and group as the standard, and thus superior, whereas all other groups are seen as inferior.

Which of the following is viewed as the riskiest and most costly form of international expansion? Multiple Choice Joint venture Wholly-owned subsidiaries Franch

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

the product of k and -5 is no more than 30

Before Muller's discovery that radiation induces mutation, scientists had to work on mutations that were found solely by phenotype differences in natural popula

Which letter represents the location of the resister in this diagram? A B C D

Quinn can type a report in 3 hours and his older sister takes 5 hours to type the same report. Working together, how long should it take them to complete the ta

A nursing student who has a history of brain tumors that resulted in partial removal of her pituitary gland years ago is asking her OB/GYN doctor about her abil

A researcher studying the nutritional value of a new candy places a 5.90 g sample of the candy inside a bomb calorimeter and combusts it in excess oxygen. The o