starbuck1216 starbuck1216

11-01-2018
Mathematics

contestada

Write the percent as a fraction or mixed number as a percent 1 21/50

Respuesta :

Vividerla Vividerla

11-01-2018

1.42 as a decimal, 71/50 as a fraction, and 142% as a percent.
Brainliest please!

Answer Link

Otras preguntas

Cultural analysis researchers and critical, cultural studies scholars favor: a. Quantitative research methods b. Communication science methods c. Qualitative re

carla has a credit limit of $4500 on her credit card, Each month she charges about $250 and makes a payment of $175. Estimate the number of months that Carla ca

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of

Aurora talks to her therapist about a recurring dream in which she encounters a ferocious lion that has just escaped from local zoo. She works with her therapis

Buster is hungry for a Garcia's pizza. Because he is new in town, he doesn’t have the number memorized. He looks up the number and repeats it to himself as he g

Stimulants purchased over the counter are always safe .

Suppose the two tryptophan codons within the leader peptide of the trp operon were changed from tryptophan to asparagine. Predict if attenuation (premature term

MATLAB graphics user interface: Describe what Folder, Command Window and Workspace are.

The line plot shows the number of bags of grapes, grouped by weight, to the nearest 18 pound. How many bags of grapes had a weight of 38 pound or less?

This information relates to Wildhorse Co.. 1. On April 5, purchased merchandise from Carla Vista Company for $28,200, terms 2/10, n/30. 2. On April 6, paid fre