camigr7 camigr7

09-04-2018
History

contestada

.The U.S. should have gotten involved in the Korean and Vietnam wars. true or false and why?

Respuesta :

Gianpilato Gianpilato

09-04-2018

False, because we had no right to send our troops there since it is not our territory or duty to help any country in danger. Except only to stop the spread of communism and spread democracy.

Answer Link

Otras preguntas

Find the volume of the figure. Express the answer in terms of it and then round to the nearest whole number. 18 cm The volume of the figure is exactly (Type an

What is the equilibrium constant for a voltaic cell at 25°C with an E°cell of 0.528 V where n = 1? Express your answer to two decimal places. Express your ans

Which of the following job sites have a low rate of fatal accidents but a high rate of nonfatal accidents? (Select all that apply.) a) Construction sites b) Off

When a force of constant magnitude always act perpendicular to the motion of a particle then:A. Velocity is constantB. Acceleration is constantC. K.E. is consta

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Which of the following types of mutual funds would be most likely to have capital appreciation as its stated objective? a) Growth fund b) Income fund c) Balance

SEMA3A directs blood vessel growth by repulsion; when bound to NRP-1, VEGF-A mediates vascular permeability and angiogenesis. Which of the following best descri

Which of the following is a way that Al could influence the creative arts in AI in the world? Al determines the desired result. Al writes best-selling books. Al

Which of the following are ways of regulating gene expression in both prokaryotes and eukaryotes? Multiple select question. a) DNA methylation b) Histone modifi

Gregor mendel developed some basic principles of heredity by: a) cutting off the tails of mice b) culturing bacteria in a laboratory c) crossing pea plantsd) br